ComputeFop: Frequency of Optimal Codons

In fredysiegrist/statanacoseq: Statistical Analyses of Codon Usage in Custom Genome Sequences

Description

ComputeFop calculates ratio of optimal codons used to the sum of synonymous codons

Usage

ComputeFop(cds, db, ref = c("tRNAgene", "mostcommon"), codonusagec = NULL)

Arguments

cds	Coding sequence in reading frame
db	CDS list to generate codon usage count table if NULL
ref	'tRNAgene' takes tRNA gene copy number of isotypes out of genomic data given in codonusagec and 'mostcommon' takes optimal codons as those that are the most common in a database or calculates it from a set of reference genes given as db
codonusagec	Codon usage count table

Details

Based on early codon usage mesures proposed by Ikemura 1981. Original implementation from Alexander Roth 2005-2007, first of several indices for codon usage.

Value

Numerical value for ratio of optimal codons (total number of optimal codons / total number of codons included in the analysis)

Author(s)

Roth, A.; Siegrist, F. and Cannarozzi, G. M. [e-mail]

See Also

seqinr statanacoseq http://gtrnadb.ucsc.edu/GtRNAdb2/ readstats

Examples

ComputeFop('ATGTGGTACTCCGACTACGGAGGATAA', ref='tRNAgene', codonusagec=Tef)
ComputeFop(c2s(mylist(whatout=1)[[1]]), ref='mostcommon', codonusagec=CodonUsage())

fredysiegrist/statanacoseq documentation built on May 16, 2019, 2:44 p.m.