Description Usage Arguments Details Value Author(s) See Also Examples
ComputeFop calculates ratio of optimal codons used to the sum of synonymous codons
1 | ComputeFop(cds, db, ref = c("tRNAgene", "mostcommon"), codonusagec = NULL)
|
cds |
Coding sequence in reading frame |
db |
CDS list to generate codon usage count table if NULL |
ref |
'tRNAgene' takes tRNA gene copy number of isotypes out of genomic data given in codonusagec and 'mostcommon' takes optimal codons as those that are the most common in a database or calculates it from a set of reference genes given as db |
codonusagec |
Codon usage count table |
Based on early codon usage mesures proposed by Ikemura 1981. Original implementation from Alexander Roth 2005-2007, first of several indices for codon usage.
Numerical value for ratio of optimal codons (total number of optimal codons / total number of codons included in the analysis)
Roth, A.; Siegrist, F. and Cannarozzi, G. M. gina@cannarozzi.com
seqinr statanacoseq http://gtrnadb.ucsc.edu/GtRNAdb2/ readstats
1 2 | ComputeFop('ATGTGGTACTCCGACTACGGAGGATAA', ref='tRNAgene', codonusagec=Tef)
ComputeFop(c2s(mylist(whatout=1)[[1]]), ref='mostcommon', codonusagec=CodonUsage())
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.