groupReport-MotifEnrichmentResults-method: Generate a motif enrichment report for the whole group of...
In PWMEnrich: PWM enrichment analysis

Description Usage Arguments Value Examples

Generate a motif enrichment report for the whole group of sequences together

1 2	## S4 method for signature 'MotifEnrichmentResults' groupReport(obj, top = 0.05, bg = TRUE, by.top.motifs = FALSE, ...)

`obj`	a MotifEnrichmentResults object
`top`	what proportion of top motifs should be examined in each individual sequence (by default 0.05, i.e. 5%)
`bg`	if to use background corrected P-values to do the ranking (if available)
`by.top.motifs`	if to rank by the proportion of sequences where the motif is within 'top' percentage of motifs
`...`	unused

a MotifEnrichmentReport object containing a table with the following columns:

'rank' - The rank of the PWM's enrichment in the whole group of sequences together
'target' - The name of the PWM's target gene, transcript or protein complex.
'id' - The unique identifier of the PWM (if set during PWM creation).
'raw.score' - The raw score before P-value calculation
'p.value' - The P-value of motif enrichment (if available)
'top.motif.prop' - The proportion (between 0 and 1) of sequences where the motif is within top proportion of enrichment motifs.

if(requireNamespace("PWMEnrich.Dmelanogaster.background")){
   ###
   # load the pre-compiled lognormal background
   data(PWMLogn.dm3.MotifDb.Dmel, package = "PWMEnrich.Dmelanogaster.background")

   # scan two sequences for motif enrichment
   sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), 
     DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))

   res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)

   # produce a report for all sequences taken together
   r.default = groupReport(res)

   # produce a report where the last column takes top 1% motifs
   r = groupReport(res, top=0.01)

   # view the results
   r

   # plot the top 10 most enriched motifs
   plot(r[1:10])

}