motifScores: Motif affinity or number of hits over a threshold
In PWMEnrich: PWM enrichment analysis

Description Usage Arguments Value Examples

Scan a number of sequences either to find overall affinity, or a number of hits over a score threshold.

motifScores(
  sequences,
  motifs,
  raw.scores = FALSE,
  verbose = TRUE,
  cutoff = NULL
)

`sequences`	a set of sequences to be scanned, a list of DNAString or other scannable objects
`motifs`	a list of motifs either as frequency matrices (PFM) or as PWM objects. If PFMs are specified they are converted to PWMs using uniform background.
`raw.scores`	if to return raw scores (odds) for each position in the sequence. Note that scores for forward and reverse strand are concatenated into a single long vector of scores (twice the length of the sequence)
`verbose`	if to print verbose output
`cutoff`	if not NULL, will count number of matches with score above value specified (instead of returning the average affinity). Can either be one value, or a vector of values for each of the motifs.

if raw.scores=FALSE, returns a matrix of mean scores (after cutoff if any), where columns are motifs. The returned values are either mean odd scores (not log-odd), or number of hits above a threshold; otherwise if raw.scores=TRUE, returns a list of raw score values (before cutoff)

if(requireNamespace("PWMEnrich.Dmelanogaster.background")){
   data(MotifDb.Dmel, package = "PWMEnrich.Dmelanogaster.background")

   # affinity scores
   affinity = motifScores(DNAString("CGTAGGATAAAGTAACTAGTTGATGATGAAAG"), MotifDb.Dmel)
   
   # motif hit count with Patser score of 4
   counts = motifScores(DNAString("CGTAGGATAAAGTAACTAGTTGATGATGAAAG"), MotifDb.Dmel, 
     cutoff=log2(exp(4)))
   
   print(affinity)
   print(counts)

   # scanning multiple sequences
   sequences = list(DNAString("CGTAGGATAAAGTAACTAGTTGATGATGAAAG"), 
     DNAString("TGAGACGAAGGGGATGAGATGCGGAAGAGTGAAA"))
   affinity2 = motifScores(sequences, MotifDb.Dmel)
   print(affinity2)
}