motifRankingForGroup-MotifEnrichmentResults-method: Get a ranking of motifs by their enrichment in the whole set...
In PWMEnrich: PWM enrichment analysis

Description Usage Arguments Value Examples

Get a ranking of motifs by their enrichment in the whole set of sequences

## S4 method for signature 'MotifEnrichmentResults'
motifRankingForGroup(
  obj,
  bg = TRUE,
  id = FALSE,
  order = FALSE,
  rank = FALSE,
  unique = FALSE,
  ...
)

`obj`	a MotifEnrichmentResults object
`bg`	if to use background corrected P-values to do the ranking (if available)
`id`	if to show PWM IDs instead of target TF names
`order`	if to output the ordering of PWMs instead of actual P-values or raw values
`rank`	if the output should be rank of a PWM instead of actual P-values or raw values
`unique`	if TRUE, only the best rank is taken for each TF (only when id = FALSE, order = FALSE)
`...`	currently unused

a vector of P-values or raw enrichments sorted such that the first motif is most enriched

if(requireNamespace("PWMEnrich.Dmelanogaster.background")){
   ###
   # load the pre-compiled lognormal background
   data(PWMLogn.dm3.MotifDb.Dmel, package = "PWMEnrich.Dmelanogaster.background")

   # scan two sequences for motif enrichment
   sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), 
     DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))
   res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)

   # most enriched in both sequences (sorted by lognormal background P-value)
   head(motifRankingForGroup(res))

   # Return a non-redundant set of TFs
   head(motifRankingForGroup(res, unique=TRUE))

   # sorted by raw affinity instead of P-value
   head(motifRankingForGroup(res, bg=FALSE))

   # show IDs instead of target TF names
   head(motifRankingForGroup(res, id=TRUE))

   # output the rank instead of P-value
   head(motifRankingForGroup(res, rank=TRUE))
}