alignShortReads: Exact alignment of DNA sequences against a reference

Description Usage Arguments Details Value Author(s) See Also Examples

Description

This method aligns given sequences against a given reference genome using the matchPDict method. Only exact (no errors) and unique matches are returned.

Usage

1
alignShortReads(object, bsGenome, seqNames, ensemblNotation)

Arguments

object

The reads that should be aligned agiven either as a DNAStringSet or a AVASet instance. In the latter case the reference sequences are extracted and aligned.

bsGenome

A bsGenome instance providing the reference sequences.

seqNames

The names of the sequences in bsGenome that should be used. If omitted, all reference sequences are used.

ensemblNotation

If set to TRUE, “chr” is removed from the reference sequences' names in the returned alignment. Default value is FALSE.

Details

All reads are aligned against the reference and its reverse complement. If the reads are not in 5' to 3' orientation, they should be reversed before. Note that only exact and unique alignments are reported. Use matchPDict directly for more flexibility.

Value

An object of class AlignedRead or a AVASet instance.

Author(s)

Hans-Ulrich Klein

See Also

matchPDict, DNAStringSet, AlignedRead, AVASet

Examples

1
2
3
4
5
library("BSgenome.Scerevisiae.UCSC.sacCer2")
reads = DNAStringSet(c(
  "CCGTTCAAAGAGCCCTTGGCCCATAATCCACCGGTT",
  "ATCCTGCCACAGGAGTCCATGGAGGTTTCGCCA"))
alignShortReads(reads, Scerevisiae, seqNames="chrIII")

R453Plus1Toolbox documentation built on Nov. 1, 2018, 2:27 a.m.