Description Usage Format Details Source References Examples
A melting curve for adk was performed.
1 | data("C317.melt.hr")
|
A data frame with 40 observations on the following 97 variables. The first column ("Temperature") contains the temperature (resolution: 0.1 degrees Celsius / step) and consecutive columns contain the replicates ("A1" to "H12").
adk was amplified in the Bio-Rad CFX96. After PCR, the temperature-dependent change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study.
adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC
PCR conditions: C317.amp
Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
1 2 3 |
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.