#' @title A function to annotate salmon output
#' @description This function executes a docker that convert the transcripts count file generated by Salmon quasi-alignment in the same format of isoforms.result, geness.result of RSEM and add the ENSEMBL GTF based annotation
#' @param group, a character string. Two options: sudo or docker, depending to which group the user belongs
#' @param fastq.folder, a character string indicating the folder where input data are located and where output will be written, it should contain quant.sf file generated by salmonCounts
#' @param index.folder, a character string indicating the folder where Salmon transcriptome index was created with salmonIndex.
#' @author Raffaele Calogero, raffaele.calogero [at] unito [dot] it, Bioinformatics and Genomics unit, University of Torino Italy
#'
#' @examples
#' \dontrun{
#' system("wget http://130.192.119.59/public/test_R1.fastq.gz")
#' system("wget http://130.192.119.59/public/test_R2.fastq.gz")
#' library(docker4seq)
#' #running salmonCounts
#' library(docker4seq)
#' wrapperSalmon(group="docker", scratch.folder="/data/scratch/",
#' fastq.folder=getwd(), index.folder="/data/genomes/hg38salmon",
#' threads=8, seq.type="pe", adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
#' adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", min.length=40, strandness="none")
#' #converting in a format identical to rsem isoform.results
#' salmonAnnotation(group="docker", fastq.folder=getwd(),
#' index.folder="/data/genomes/hg38salmon")
#'
#' }
#'
#' @export
salmonAnnotation <- function(group=c("sudo","docker"), fastq.folder, index.folder){
home <- getwd()
#running time 1
ptm <- proc.time()
#setting the data.folder as working folder
if (!file.exists(fastq.folder)){
cat(paste("\nIt seems that the ",fastq.folder, " folder does not exist\n"))
return(2)
}
setwd(fastq.folder)
#initialize status
system("echo 0 > ExitStatusFile 2>&1")
params <- paste("--cidfile ",fastq.folder,"/dockerID -v ",fastq.folder,":/data/scratch -v ",index.folder,":/index -d docker.io/repbioinfo/r340.2017.01 Rscript /bin/annotate.salmon.R", sep="")
resultRun <- runDocker(group=group, params=params)
#waiting for the end of the container work
if(resultRun==0){
cat("\nSalmon output annotation is finished\n")
#saving log and removing docker container
container.id <- readLines(paste(fastq.folder,"/dockerID", sep=""), warn = FALSE)
system(paste("docker logs ", substr(container.id,1,12), " &> ","salmonTranscriptsAnnotation_",substr(container.id,1,12),".log", sep=""))
system(paste("docker rm ", container.id, sep=""))
#removing temporary folder
cat("\n\nRemoving the temporary file ....\n")
system("rm -fR dockerID")
system("rm -fR tempFolderID")
# system(paste("cp ",paste(path.package(package="docker4seq"),"containers/containers.txt",sep="/")," ",fastq.folder, sep=""))
}
#gene level conversion
params <- paste("--cidfile ",fastq.folder,"/dockerID -v ",fastq.folder,":/data/scratch -v ",index.folder,":/index -d docker.io/repbioinfo/r340.2017.01 Rscript /bin/iso2gene.R", sep="")
resultRun <- runDocker(group=group, params=params)
#waiting for the end of the container work
if(resultRun==0){
cat("\nSalmon output gene level conversion is finished\n")
#saving log and removing docker container
container.id <- readLines(paste(fastq.folder,"/dockerID", sep=""), warn = FALSE)
system(paste("docker logs ", substr(container.id,1,12), " &> ","salmonGeneConversion_",substr(container.id,1,12),".log", sep=""))
system(paste("docker rm ", container.id, sep=""))
#removing temporary folder
cat("\n\nRemoving the temporary file ....\n")
system("rm -fR dockerID")
system("rm -fR tempFolderID")
# system(paste("cp ",paste(path.package(package="docker4seq"),"containers/containers.txt",sep="/")," ",fastq.folder, sep=""))
}
#ensembl gtf annotation at gene level
params <- paste("--cidfile ",fastq.folder,"/dockerID -v ",fastq.folder,":/data/scratch -v ",index.folder,":/index -d docker.io/repbioinfo/r340.2017.01 Rscript /bin/salmon.annoByGtf.R", sep="")
resultRun <- runDocker(group=group, params=params)
#waiting for the end of the container work
if(resultRun==0){
cat("\nSalmon output ensembl gtf annotation at gene level is finished\n")
#saving log and removing docker container
container.id <- readLines(paste(fastq.folder,"/dockerID", sep=""), warn = FALSE)
system(paste("docker logs ", substr(container.id,1,12), " &> ","salmonGeneAnnotation_",substr(container.id,1,12),".log", sep=""))
system(paste("docker rm ", container.id, sep=""))
#removing temporary folder
cat("\n\nRemoving the temporary file ....\n")
system("rm -fR dockerID")
system("rm -fR tempFolderID")
system(paste("cp ",paste(path.package(package="docker4seq"),"containers/containers.txt",sep="/")," ",fastq.folder, sep=""))
}
#running time 2
ptm <- proc.time() - ptm
dir <- dir(fastq.folder)
dir <- dir[grep("run.info",dir)]
if(length(dir)>0){
con <- file("run.info", "r")
tmp.run <- readLines(con)
close(con)
tmp.run[length(tmp.run)+1] <- paste("user run time mins ",ptm[1]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("system run time mins ",ptm[2]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("elapsed run time mins ",ptm[3]/60, sep="")
writeLines(tmp.run,"run.info")
}else{
tmp.run <- NULL
tmp.run[1] <- paste("run time mins ",ptm[1]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("system run time mins ",ptm[2]/60, sep="")
tmp.run[length(tmp.run)+1] <- paste("elapsed run time mins ",ptm[3]/60, sep="")
writeLines(tmp.run,"run.info")
}
setwd(home)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.