#'Make trimmed and quality filtered fastq files
#'
#'\code{make_trim} uses parallel processing to generate trimmed reads.
#'
#'Given a file path to sequence files in fastq format (extension .fastq.gz or
#'.fastq) this function will first trim the sequences from adaptor sequence, and
#'then apply sequence size and phred score quality filters. On systems with low
#'memory or very large fastq files, users may choose to handle each file in
#'chunks on the expense of time performance.
#'
#'@family PAC generation
#'
#'@seealso \url{https://github.com/Danis102} for updates on the current package.
#'
#'@param input Character indicating the path to a directory containing fastq
#' formatted sequence files either compressed (.fastq.gz) or text (.fastq).
#'
#'@param output Character indicating the path to a directory where the
#' compressed trimmed fastq files should be saved (as basename trim.fastq.gz).
#'
#'@param indels Logical whether indels should be allowed in the mismatch between
#' read and adaptor sequences. Note that indel trimming will only be done on
#' fragments that have failed to be trimmed by other means. Default=TRUE.
#'
#'@param adapt_3 Character string defining the 3' adaptor sequence. In most
#' library preparation protocols, the 3' adaptor is the only adaptor needed
#' trimming.
#'
#'@param adapt_3_set Character vector with three inputs named 'type', 'min' and
#' 'mismatch' that controls 3' trimming. As default,
#' adapt_3_set=c(type="hard_rm", min=10, mismatch=0.1).
#'
#' Options for each input are: \describe{
#' \item{\strong{type}=}{
#' '\emph{hard_trim}': Trims all up to the very last nucleotide.\cr
#' '\emph{hard_rm}': Same as 'hard_trim' but removes untrimmed
#' sequences.\cr
#' '\emph{hard_save}': Same as 'hard_trim' but saves all untrimmed
#' sequences in new fastq file.\cr
#' '\emph{soft_trim}': No trimming on the last 3' nucleotides equal
#' to 1/2 of 'min'.\cr
#' '\emph{soft_rm}': Same as 'soft_trim' but removes untrimmed
#' sequences.\cr
#' '\emph{soft_save}': Same as 'soft_trim' but saves all untrimmed
#' sequences in new fastq file.
#' }
#' \item{\strong{min}=}{Integer that controls the short
#' adaptor/poly-G/concatamer trimming and
#' soft trimming. When min=10, a short version of the adaptor is
#' generated containing the 10 first nucleotides. The short version of
#' the adaptor therefore controls the minimum number of overlaps between
#' adaptor/poly-G. Short adaptor trimming will only occur on untrimmed
#' reads that have failed trimming with full adaptor. The min option also
#' controls how many terminal nucleotides that will escape trimming when
#' type is set to 'soft' (1/2 of min).
#' }
#'
#' \item{\strong{mismatch}=}{
#' Numeric controlling the percent mismatch.
#' For instance, if min=10 and
#' mismatch=0.1, then 1 mismatch is allowed in the minimum overlap.
#' }
#' }
#'
#' @param adapt_5 Character string defining a 5' adaptor sequence. 5' adaptor
#' sequences are only trimmed in specialized protocols or in very short
#' paired-end sequencing.
#'
#' @param adapt_5_set Currently not supported, but will be in future updates.
#' Same as \code{adapt_3_set} but controls the behavior of 5' trimming when a
#' sequence is provided in \code{adapt_5}.
#'
#' @param polyG Character vector with three inputs named 'type', 'min' and
#' 'mismatch' that controls poly G trimming. This trimming might be necessary
#' for fastq files from two channel illumina sequencers (e.g. NextSeq and
#' NovaSeq) where no color signals are interpreted as 'G', but where read
#' failure sometimes also results in long stretches of 'no-signal-Gs'.
#'
#' Works similar to \code{adapt_3_set} but instead of an adaptor sequence a
#' poly 'G' string is constructed from the 'min' input option. Thus, if
#' polyG=c(type="hard_rm", min=10, mismatch=0.1) then sequences containing
#' 'GGGGGGGGGGNNNNN...etc' with 10 percent mismatch will be removed from the
#' output fastq file.
#'
#' @param concat Integer setting the threshold for trimming concatemer-like
#' adaptors. Even when adaptor synthesis and ligation are strictly controlled,
#' concatemer-like ("di-") adaptor sequences are formed. When \code{concat} is
#' an integer, \code{make_trim} will search all trimmed sequences for
#' additional adaptor sequence using a shorter version of the provided adaptor
#' in \code{adapt_3}. The length of the short adaptor is controlled by
#' \code{adapt_3_set$min}. If an additional, shorter, adaptor sequence is
#' found in a read, trimming will only occur if the resulting sequence is <=
#' \strong{concat} shorter in length than the first trimmed sequence. Thus, if
#' \code{concat}=12, a read with a NNNNN-XXXXX-YYYYYYYYY composition, where N
#' is 'real' nucleotides and X/Y are two independent adaptor sequences, the
#' trimming will result in NNNNN-XXXXX. If instead \code{concat}=5 then
#' trimming will result in NNNNN. Note that setting \code{concat} too low will
#' result in trimming of real nucleotides that just happend to share sequence
#' with the adaptor. As default \code{concat}=12, which have been carefully
#' evaluated in relation to the risk of trimming real sequence. If
#' \code{concat}=NULL, concatemer-like adaptor trimming will not be done.
#'
#' @param seq_range Numeric vector with two inputs named 'min' and 'max', that
#' controls the sequence size filter. For example, if
#' \code{seq_range=c(min=15, max=50)} the function will extract sequences in
#' the range between 15-50 nucleotides after trimming. As default,
#' \code{seq_range=c(min=NULL, max=NULL)} and will retain all trimmed
#' sequences.
#'
#' @param quality Numeric vector with two inputs named 'threshold' and 'percent'
#' that controls the fastq quality filter. For example, if
#' \code{quality=c(threshold=20, percent=0.8)} (default) the function will
#' extract sequences that pass a fastq phred score >=20 in 80 percent of the
#' nucleotides after trimming. If \code{quality=c(threshold=NULL,
#' percent=NULL)} then all sequences will be retained (not default!).
#'
#' @param threads Integer stating the number of parallel jobs. Note, that
#' reading multiple fastq files drains memory, using up to 10Gb per fastq
#' file. To avoid crashing the system due to memory shortage, make sure that
#' each thread on the machine have at least 10 Gb of memory available, unless
#' your fastq files are very small or very large. Use
#' \code{parallel::detectcores()} to see available threads on the machine.
#' Never use all threads! To run large fastq on low end computer use
#' 'chunk_size'.
#'
#' @param check_mem Logical whether a memory check should be performed. A memory
#' check estimates the approximate memory usage given the fastq file sizes and
#' number of threads. The check happens before entering the parallel trimming
#' loop, and will give an immediate warning given intermediary risky memory
#' estimates, and an error if the risk is very high. Note, this option depends
#' on the parallel and benchmarkme packages. (default=FALSE)
#'
#' @param chunk_size Integer indicating the number of reads to be read into
#' memory in each chunk. When chunk_size=NULL (default), the whole fastq will
#' be processed as one. Thus, running 5 threads will keep 5 full fastq files
#' in memory simultaneously (fast but demanding). Setting chunk_size to an
#' integer will instead read only a portion of each fastq at a time and then
#' append the trimmed results on disc (slow but less demanding). Try using
#' chunk_size=1000000 reads, less will be extremely slow. Rather decrease
#' threads if you encounter memory problems.
#'
#' @return Exports a compressed trimmed fastq file to the output folder (file
#' name: basename+trim.fastq.gz). If any type="save" has been set, an
#' additional fastq file (file name includes 'REMOVED') will be exported. In
#' addition, overview statisics (progress report) will be returned as a
#' data.frame.
#'
#' @examples
#'
#' ############################################################
#' ### Seqpac fastq trimming with the make_trim function
#' ### (for more streamline options see the make_counts function)
#' ############################################################
#' ### Seqpac fastq trimming with the make_counts function
#' ### using default settings for NEBNext small RNA adaptor
#'
#' # Seqpac includes strongly down-sampled smallRNA fastq.
#' sys_path = system.file("extdata", package = "seqpac", mustWork = TRUE)
#' input <- list.files(path = sys_path, pattern = "fastq", all.files = FALSE,
#' full.names = TRUE)
#'
#' # Run make_trim using NEB-next adaptor
#' # (Here we store the trimmed files in the input folder)
#' # (but you may choose where to store them using the output option)
#'
#' input <- unique(dirname(input)) # mak_trim searches for fastq in input dir
#' output <- tempdir() # save in tempdir
#'
#'
#' list.files(input, pattern = "fastq") #before
#'
#' prog_report <- make_trim(
#' input=input, output=output, threads=1,
#' adapt_3_set=c(type="hard_rm", min=10, mismatch=0.1),
#' adapt_3="AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTA",
#' polyG=c(type="hard_trim", min=20, mismatch=0.1),
#' seq_range=c(min=14, max=70),
#' quality=c(threshold=20, percent=0.8))
#'
#' list.files(path = output, pattern = "fastq") #after
#'
#' # How did it go? Check progress report:
#' prog_report
#'
#'
#' ## The principle:
#' # input <- "/some/path/to/untrimmed_fastq_folder"
#' # output <- "/some/path/to/output_folder_for_trimmed_fastq"
#' #
#' # prog_report <- make_trim(
#' # input=input, output=output,
#' # threads=<how_many_parallel>,
#' # check_mem=<should_memory_be_checked?>,
#' # adapt_3_set=<options_for_main_trimming,
#' # adapt_3=<sequence_to be trimmed,
#' # polyG=<Illumina_Nextseq_type_poly_G_trimming>,
#' # seq_range=<what_sequence_range_to_save>,
#' # quality=<quality_filtering_options>))
#' @export
### make_trim ###
# This function applies getTrim over parallel fastq (foreach)
# It also manage chunks by appending trimmed fastq in a while loop
# Updates progress report for each progressive chunk across all fastq
make_trim <- function(input, output, indels=TRUE, concat=12, check_mem=FALSE,
threads=1, chunk_size=NULL,
polyG=c(type=NULL, min=NULL, mismatch=NULL),
adapt_3_set=c(type="hard_rm", min=10, mismatch=0.1),
adapt_3="AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTA",
adapt_5_set=c(type=NULL, min=NULL, mismatch=NULL),
adapt_5=NULL,
seq_range=c(min=NULL, max=NULL),
quality=c(threshold=20, percent=0.8)){
##### General setup #######################################
# Check if files or dir is given as input
nam_trim <- nam <- fls <- NULL
fls <- list.files(input, pattern ="fastq.gz\\>|\\.fastq\\>",
full.names=TRUE, recursive=TRUE, include.dirs = TRUE)
if(length(fls) == 0){
fls <- input
}
if(any(!file.exists(fls))){
stop("Something is wrong with input file(s)/path!")
}
# Memory check
if(check_mem==TRUE){
cat("\nChecking trimming memory usage with benchmarkme...")
mem <- as.numeric(benchmarkme::get_ram()/1000000000)
mem <- round(mem*0.931, digits=1)
cor <- parallel::detectCores()
if(threads > cor*0.8){
cat(paste0(
"\n--- Input will use >80% of availble cores",
"(", threads, "/", cor, ")."))
}
cat("\n--- Heavy trimming processes needs approx.",
"x10 the fastq file size available in RAM memory.")
if(threads>length(fls)){
par_ns <- length(fls)
}else{
par_ns <- threads
}
worst <- sum(sort(file.info(fls)$size,
decreasing = TRUE)[seq.int(par_ns)])/1000000000
worst <- round(worst*12, digits=1)
cat(paste0("\n--- Worst scenario maximum system",
" burden is estimated to ",
worst, " GB of approx. ", mem," GB RAM available."))
if(worst>0){
if(worst*1.1 > mem){
warning("\nIn worst scenario trimming may generate an impact",
" close to what the system can stand.",
"\nPlease free more memory per thread if function fails.",
immediate. = TRUE)
}
if(worst*0.5 > mem){
stop("\nTrimming will generate an impact well above what the",
" system can stand.",
"\nIf you still wish to try, please set check_mem=FALSE.")
}
}
cat(paste0("\n--- Trimming check passed.\n"))
}
# Make new output file name
nam <- gsub("\\.gz$", "", basename(fls))
nam <- gsub("\\.fastq$|\\.fq$|fastq$", "", nam)
nam <- gsub("\\.$|\\.tar$", "", nam)
nam_trim <- paste0(nam, ".trim.fastq.gz")
# Check for output folder
out_file <- file.path(output, nam_trim)
out_exist <- file.exists(out_file)
if(any(out_exist)){
stop("\n There are files in the output folder:\n ",
output,
"\n Please move or delete those file(s).")
}
# Make dir
if(!dir.exists(output)){
if(!dir.exists(output)){
logi_create <- try(dir.create(output), silent=TRUE)
if(!is(logi_create, "try-error")){
if(any(!logi_create)){
warning("Was unable to create ", output,
"\nProbable reason: Permission denied")
}
}
}
}
##### Make adaptor trimming 5' (moves to getTrim in future upgrades) ####
if(!is.null(adapt_5)){
stop("\n5' trimming is currently not supported, but will be included in",
" future updates of seqpac.\nFor now you can use the 'make_cutadapt' ",
" function to parse a 5' argument to cutadapt.",
"\nNote, that 'make_cutadapt' depends on externally installed ",
" versions of \ncutadapt and fastq_quality_filter.")
}
##### Enter parallel loops and reading fastq #########################
cat("\nNow entering the parallel trimming loop (R may stop respond) ...")
cat(paste0("\n(progress may be followed in: ", output, ")"))
# save the input for getTrim function
par_parse <- list(output=output, indels=indels, concat=concat,
polyG=polyG, adapt_3_set=adapt_3_set, adapt_3=adapt_3,
adapt_5_set=adapt_5_set, adapt_5=adapt_5, quality=quality,
chunk_size=chunk_size, seq_range=seq_range)
doParallel::registerDoParallel(threads)
`%dopar%` <- foreach::`%dopar%`
prog_report <- foreach::foreach(
i=seq_along(fls), .inorder = TRUE, .export= c("nam_trim", "nam"),
.final = function(x){names(x) <- basename(fls); return(x)}) %dopar% {
##### Make a while loop that works for both full size fastq and chunks ###
max_chu <- FALSE
current_chu <- 1
while(!max_chu){
### Without chunks
if(is.null(chunk_size)){
# immediately update max_chu for full size fastq
# while-loop should run only once
max_chu <- TRUE
fstq <- paste0(ShortRead::sread(ShortRead::readFastq(fls[[i]],
withIds=FALSE)))
fstq_sav <- NULL
}
### With chunks (loop should run until all chunks is completed)
if(!is.null(chunk_size)){
# Setup n chunks (only in 1st loop)
if(current_chu==1){
fq_lng <- ShortRead::countLines(fls[[i]])
fq_lng <- fq_lng/4
n_chunks <- as.integer(ceiling(fq_lng/chunk_size))
sampl <- ShortRead::FastqStreamer (fls[[i]], chunk_size)
}
# Stream fastq
# the stream object will automatically update with yield
# therefore, cannot be generated more than once per full fastq
# for chunks read withIds=TRUE to obtain seq names (needed later)
fstq_sav <- ShortRead::yield(sampl, withIds=TRUE)
fstq <- paste0(ShortRead::sread(fstq_sav))
} #Reading fastq done, now run getTrim function
##### Run getTrim ##################################
# Progress report needs to be progressively built for chunks
in_fl <- fls[[i]]
out_fl <- out_file[[i]]
if(current_chu == 1|is.null(chunk_size)){
prog_report <- getTrim(fstq, fstq_sav, in_fl, out_fl, par_parse)
}else{
prog_report_temp <- getTrim(fstq, fstq_sav, in_fl, out_fl, par_parse)
}
# Update progress report for chunks appending 1st report
if(!is.null(chunk_size)){
if(!current_chu == 1){
prog_report$tot_reads <-
sum(prog_report$tot_reads,
prog_report_temp$tot_reads)
prog_report$out_reads <-
sum(prog_report$out_reads,
prog_report_temp$out_reads)
if(!is.null(polyG)){
prog_report$polyG["trimmed"] <-
sum(as.numeric(prog_report$polyG["trimmed"]),
as.numeric(prog_report_temp$polyG["trimmed"]))
}
if(!is.null(adapt_3)){
prog_report$trim_3["trimmed"] <-
sum(as.numeric(prog_report$trim_3["trimmed"]),
as.numeric(prog_report_temp$trim_3["trimmed"]))
}
if(!is.null(adapt_5)){
prog_report$trim_5["trimmed"] <-
sum(as.numeric(prog_report$trim_5["trimmed"]),
as.numeric(prog_report_temp$trim_5["trimmed"]))
}
if(!is.null(quality)){
prog_report$quality["removed"] <-
sum(prog_report$quality["removed"],
prog_report_temp$quality["removed"])
}
if(!is.null(seq_range)){
prog_report$size["removed"] <-
sum(prog_report$size["removed"],
prog_report_temp$size["removed"])
}
}
}
# Update and check current chunk after yield()
# When the whole fastq has been streamed, change max_chu
if(!is.null(chunk_size)){
current_chu <- current_chu+1
status <- sampl$.status["added"]
if(fq_lng - status == 0){
max_chu <- TRUE
}
}
} # while loop end
return(prog_report)
} # foreach loop end
cat("\nDone trimming")
doParallel::stopImplicitCluster()
gc(reset=TRUE)
##### Merge full progress report#############################
nams_prog <- as.list(names(prog_report[[1]]))
names(nams_prog) <- unlist(nams_prog)
prog_report <- lapply(nams_prog, function(x){
lst_type <- list(NULL)
for(i in seq.int(length(prog_report))){
lst_type[[i]] <- cbind(data.frame(file=names(prog_report)[i],
stringsAsFactors = FALSE),
t(data.frame(prog_report[[i]][x],
stringsAsFactors = FALSE)))
}
do.call("rbind", lst_type)
})
report_fin <- prog_report$tot_reads
rownames(report_fin) <- NULL
colnames(report_fin)[2] <- "input_reads"
for(i in seq.int(length(prog_report))){
rprt <- prog_report[[i]]
rprt_nam <- names(prog_report)[i]
if(rprt_nam=="polyG"){
trim <- as.numeric(as.character(rprt$trimmed))
perc <- paste0(
"(", round(trim/report_fin$input_reads, digits=4)*100, "%)"
)
set <- paste0(rprt$type,"|min", rprt$min,"|mis", rprt$mismatch)
report_fin <- cbind(report_fin,
data.frame(polyG_set=set,
polyG= paste(trim, perc),
stringsAsFactors = FALSE))
}
if(rprt_nam=="trim_3"){
trim <- as.numeric(as.character(rprt$trimmed))
perc <- paste0("(",
round(trim/report_fin$input_reads, digits=4)*100,
"%)")
set <- paste0(rprt$type,"|min", rprt$min,"|mis", rprt$mismatch)
report_fin <- cbind(report_fin,
data.frame(trim3_set=set,
trim3= paste(trim, perc),
stringsAsFactors = FALSE))
}
if(rprt_nam=="trim_5"){
trim <- as.numeric(as.character(rprt$trimmed))
perc <- paste0("(",
round(trim/report_fin$input_reads, digits=4)*100,
"%)")
set <- paste0(rprt$type,"|min", rprt$min,"|mis", rprt$mismatch)
report_fin <- cbind(report_fin,
data.frame(trim5_set=set,
trim5= paste(trim, perc),
stringsAsFactors = FALSE))
}
if(rprt_nam=="size"){
shrt <- as.numeric(as.character(rprt$too_short))
lng <- as.numeric(as.character(rprt$too_long))
tot_size <- shrt+lng
perc <- paste0("(",
round(tot_size/report_fin$input_reads,
digits=4)*100, "%)")
set <- paste0("min", rprt$min, "|max", rprt$max)
report_fin <- cbind(report_fin,
data.frame(size_set=set,
'size_short_long'= paste0(shrt, "/",
lng, " ",
perc),
stringsAsFactors = FALSE))
}
if(rprt_nam=="quality"){
rmvd <- as.numeric(as.character(rprt$removed))
perc <- paste0("(",
round(rmvd/report_fin$input_reads, digits=4)*100,
"%)")
set <- paste0("thresh", rprt$threshold, "|perc", rprt$percent)
report_fin <- cbind(report_fin,
data.frame(quality_set=set,
'quality_removed'= paste0(rmvd, " ",
perc),
stringsAsFactors = FALSE))
}
if(rprt_nam=="out_reads"){
out <- as.numeric(as.character(rprt[,2]))
perc <- paste0("(", round(out/report_fin$input_reads, digits=4)*100, "%)")
report_fin <- cbind(report_fin,
data.frame(output_reads= paste(out, perc),
stringsAsFactors = FALSE))
}
}
return(report_fin)
}
##### getTrim function #### (Unexported)
# This function runs from within make_trim to obtain trimming coordinates
# and to save fastq to output, appending to existing fastq for chunks
# and not appending for chunk_size=NULL
getTrim <- function(fstq, fstq_sav=NULL, in_fl=NULL, out_fl=NULL, par_parse){
# Unfold par_parse
output <- par_parse$output
indels <- par_parse$indels
concat <- par_parse$concat
quality <- par_parse$quality
chunk_size <- par_parse$chunk_size
seq_range <- par_parse$seq_range
polyG <- par_parse$polyG
adapt_3_set <- par_parse$adapt_3_set
adapt_3 <- par_parse$adapt_3
# Save lists
sav_lst <- list(NA)
coord_lst <- list(NA)
trim_filt <- list(NA)
# num_fact can be used to apply new trimming coordinates later
num_fact <- as.factor(fstq)
rm(fstq)
gc(reset=TRUE)
sav_lst$tot_reads <- length(num_fact)
seqs <- Biostrings::DNAStringSet(levels(num_fact))
num_fact <- as.numeric(num_fact)
lgn <- nchar(paste0(seqs))
mxlgn <- max(lgn)
if(!length(unique(lgn)) == 1){
warning("\nDiffering read lengths prior to adapter trimming.",
"\nHave you already performed 3'-trimming?")
}
#########################################################
##### Make NextSeq/NovaSeq poly-G trimming/filter #######
if(!is.null(polyG)){
mn <- as.numeric(polyG[names(polyG)=="min"])
mis <- as.numeric(polyG[names(polyG)=="mismatch"])
tp <- polyG[names(polyG)=="type"]
ns <- mxlgn-mn
shrt_ns <- paste0(paste(rep("G", mn), collapse=""),
paste(rep("N", ns), collapse=""))
adapt_mis_corr <- mis*(mn/mxlgn) # Correction for N length extension
trim_seqs <- Biostrings::trimLRPatterns(
subject=seqs, ranges=TRUE, Rfixed=FALSE,
Rpattern=shrt_ns, max.Rmismatch=adapt_mis_corr)
coord_lst$polyG <- tibble::tibble(Biostrings::end(trim_seqs))
sav_lst$polyG <- c(trimmed=sum(!coord_lst$polyG==lgn), polyG)
rm(trim_seqs)
# Type
if(grepl("soft", tp)){
end_vect <- mn*0.5-1
end_vect <- lgn - end_vect
logi_update <- coord_lst$polyG[[1]] >= end_vect
coord_lst$polyG[[1]][logi_update] <- lgn[logi_update]
rm(logi_update, end_vect)
}
if(grepl("rm|save|hard", tp)){
trim_filt$polyG <- coord_lst$polyG[[1]] == lgn # Not polyG
}
}
gc(reset=TRUE)
#####################################
##### Make adaptor trimming 3' ######
if(!is.null(adapt_3)){
## setup
mn <- as.numeric(adapt_3_set[names(adapt_3_set)=="min"])
mis <- as.numeric(adapt_3_set[names(adapt_3_set)=="mismatch"])
tp <- adapt_3_set[names(adapt_3_set)=="type"]
## Setup adapter sequences
adapt_lgn <- nchar(adapt_3)
ns <- mxlgn-adapt_lgn
adapt_ns <- paste0(adapt_3, paste(rep("N", ns), collapse=""))
adapt_shrt <- paste(c(substr(adapt_3, 1, mn),
rep("N", mxlgn-mn)), collapse="")
## Trim perfect
trim <- Biostrings::end(
Biostrings::trimLRPatterns(subject=seqs, ranges=TRUE, Rfixed=FALSE,
with.Rindels = FALSE, Rpattern=adapt_ns,
max.Rmismatch=0))
## Trim mis
trim_mis <- Biostrings::end(
Biostrings::trimLRPatterns(subject=seqs, ranges=TRUE, Rfixed=FALSE,
with.Rindels = FALSE, Rpattern=adapt_ns,
max.Rmismatch=mis))
# Only update larger differences will prevent nugging
logi_diff <- (trim - trim_mis) >=5
trim[logi_diff] <- trim_mis[logi_diff]
rm(logi_diff, trim_mis)
## Trimming wobbling starts
if(mis>=0.1){
if(nchar(adapt_3)< 25){
warning("Your trimming sequence was shorter than 25 nt.",
"\nFor best trimming results in the terminals using",
"\nmismatches, please provide a longer adaptor sequence.")
}
}
shrtst_lgn <- 15
sb <- nchar(adapt_3)-1
adapt_lgn <- nchar(adapt_3)
start_gone <- list(NULL)
while(sb >= shrtst_lgn){
strt <- adapt_lgn-sb+1
start_gone[[sb]] <- paste0(
c(substr(adapt_3, strt, nchar(adapt_3)),
rep("N", mxlgn-(adapt_lgn-strt+1))), collapse="")
sb <- sb-1
}
start_gone <- unlist(start_gone[!unlist(lapply(start_gone, is.null))])
trim_mt <- list(NULL)
for(z in seq.int(length(start_gone))){
shrt_ns <- start_gone[z]
n_Ns <- stringr::str_count(shrt_ns, "N")
adapt_mis_corr <- (mis*(nchar(shrt_ns)-n_Ns))/nchar(shrt_ns)
trim_seqs <- Biostrings::trimLRPatterns(
subject=seqs, ranges=TRUE, Rfixed=FALSE, with.Rindels = FALSE,
Rpattern=start_gone[z], max.Rmismatch=adapt_mis_corr)
trim_mt[[z]] <- tibble::tibble(Biostrings::end(trim_seqs))
}
trim_mt <- do.call("cbind", trim_mt)
trim_mt <- unlist(apply(trim_mt, 1, function(x){min(unique(x))<=1}))
trim[trim_mt] <- 0
rm(start_gone, trim_mt)
## Trimming indels
if(indels==TRUE){
logi_long <- trim >= lgn-5
seqs_long <- seqs[logi_long] #Apply trimming only on long (untrimmed)
trim_seqs_indel <- Biostrings::end(
Biostrings::trimLRPatterns(
subject=seqs_long, ranges=TRUE, Rfixed=FALSE,
with.Rindels = TRUE, Rpattern=adapt_shrt, max.Rmismatch=0))
trim_seqs_indel_2 <- Biostrings::end(
Biostrings::trimLRPatterns(
subject=seqs_long, ranges=TRUE, Rfixed=FALSE,
with.Rindels = TRUE, Rpattern=adapt_ns,
max.Rmismatch=2/nchar(adapt_ns)))
trim[logi_long] <- ifelse(
(trim_seqs_indel - trim_seqs_indel_2) > 5,
trim_seqs_indel_2,
trim_seqs_indel)
rm(trim_seqs_indel, trim_seqs_indel_2, logi_long, seqs_long)
}
## Trim concatemer-like adaptors
if(!is.null(concat)){
n_Ns <- stringr::str_count(adapt_shrt, "N")
adapt_mis_corr <- (mis*(nchar(adapt_shrt)-n_Ns))/nchar(adapt_shrt)
trim_shrt <- Biostrings::end(Biostrings::trimLRPatterns(
subject=seqs, ranges=TRUE, Rfixed=FALSE, with.Rindels = FALSE,
Rpattern=adapt_shrt, max.Rmismatch=adapt_mis_corr))
# Only update if more/equal to concat
logi_dim <- (trim - trim_shrt) >= concat
# Check that adaptor is present inbetween
chck <- substr(seqs[logi_dim], trim_shrt[logi_dim]+1, trim[logi_dim])
n_Ns <- stringr::str_count(adapt_ns, "N")
adapt_mis_corr <- (mis*(nchar(adapt_ns)-n_Ns))/nchar(adapt_ns)
chck <- agrepl(gsub("N", "", adapt_shrt),
chck, max.distance = 0.1,
fixed=TRUE)
logi_dim[logi_dim] <- chck # Update only where check was confirmed
trim[logi_dim] <- trim_shrt[logi_dim] # Update trim
rm(logi_dim, trim_shrt, chck)
}
## Subdivide short adaptor
logi_long <- trim >= lgn-5
seqs_long <- seqs[logi_long]
adapt_shrt1 <- paste(c(substr(adapt_3, 1, 10),
rep("N", mxlgn-nchar(substr(adapt_3, 1, 10)))),
collapse="")
trim_catch1 <- Biostrings::end(Biostrings::trimLRPatterns(
subject=seqs_long, ranges=TRUE, Rfixed=FALSE, with.Rindels = TRUE,
Rpattern=adapt_shrt, max.Rmismatch=2/nchar(adapt_shrt)))
adapt_shrt2 <- paste(c(
substr(adapt_3, 11, 20),
rep("N", mxlgn-nchar(substr(adapt_3, 11, 20)))),
collapse="")
trim_catch2 <- Biostrings::end(
Biostrings::trimLRPatterns(
subject=seqs_long, ranges=TRUE, Rfixed=FALSE, with.Rindels = TRUE,
Rpattern=adapt_shrt2, max.Rmismatch=2/nchar(adapt_shrt2)))
adapt_shrt3 <- paste(c(substr(adapt_3, 21, 30),
rep("N", mxlgn-nchar(substr(adapt_3, 21, 30)))),
collapse="")
trim_catch3 <- Biostrings::end(
Biostrings::trimLRPatterns(subject=seqs_long, ranges=TRUE,
Rfixed=FALSE, with.Rindels = TRUE,
Rpattern=adapt_shrt3,
max.Rmismatch=2/nchar(adapt_shrt3)))
logi_1 <- (trim_catch2-trim_catch1) %in% (10-3):(10+1)
logi_2 <- (trim_catch3-trim_catch1) %in% (20-3):(20+1)
logi_3 <- (trim_catch3-trim_catch2) %in% (10-3):(10+1)
trim_catch <- rep(75, times=length(seqs_long))
trim_catch[logi_1] <- trim_catch1[logi_1]
trim_catch[logi_2] <- trim_catch1[logi_2]
trim_catch[logi_3] <- (trim_catch2-9)[logi_3]
trim[logi_long] <- trim_catch
rm(logi_long, seqs_long, trim_catch, trim_catch1,
trim_catch2, trim_catch3, logi_1, logi_2, logi_3)
## Correct for biostring mis-start
sb_read <- substr(seqs, trim-2, trim+6)
corrct <- stringr::str_locate(sb_read, substr(adapt_3, 1, 5))[,"start"]
corrct2 <- stringr::str_locate(sb_read, substr(adapt_3, 1, 3))[,"start"]
corrct <- corrct-4
corrct2 <- corrct2-4
corrct[is.na(corrct)] <- corrct2[is.na(corrct)] # Only update NA
corrct[is.na(corrct)] <- 0 # Remaining NAs becomes 0
trim <- (trim + corrct) # Add adjusted tims sites
rm(corrct, corrct2)
## Add to coordinate list
coord_lst$trim_3 <- tibble::tibble(trim)
rm(trim)
gc(reset=TRUE)
## Correct for type
if(grepl("soft", tp)){
end_vect <- mn*0.5
end_vect <- lgn - end_vect
logi_update <- coord_lst$trim_3[[1]] >= end_vect
coord_lst$trim_3[[1]][logi_update] <- lgn[logi_update]
rm(logi_update, end_vect)
}
if(grepl("rm|save|hard", tp)){
trim_filt$trim_3 <- coord_lst$trim_3[[1]] == lgn # Not trim 3
}
}
sav_lst$trim_3 <- c(trimmed=sum(!trim_filt$trim_3),
adapt_3_set, adapt=adapt_3)
rm(lgn)
gc(reset=TRUE)
################################################
##### Apply trimming coordinates on fastq ######
## Apply on sequences
coord_lst <- coord_lst[!is.na(coord_lst)]
sav_lst <- sav_lst[!is.na(sav_lst)]
coord_lst <- apply(tibble::as_tibble(
do.call("cbind", coord_lst)), 1, min)
trim_fastq <- substring(seqs, 1, coord_lst)
trim_fastq <- trim_fastq[num_fact] # Order as original fastq
##### Read and then update fastq to obtain original seq names ######
# contains index etc
# chunk fastq will be kept in memory the whole time
if(is.null(chunk_size)){
fstq <- ShortRead::readFastq(in_fl)
}else{
fstq <- fstq_sav
}
fstq@sread <- Biostrings::DNAStringSet(trim_fastq) #test this
## Apply on quality
if(!is.null(quality)){
qual <- paste(Biostrings::quality(fstq@quality))
qual <- substr(qual, start=1, stop=coord_lst[num_fact])
fstq@quality <- ShortRead::FastqQuality(Biostrings::BStringSet(qual))
}
rm(trim_fastq, coord_lst)
gc(reset=TRUE)
########################################################
##### Filter non-trimmed depending type ######
trim_filt <- trim_filt[!is.na(trim_filt)]
trim_filt <- lapply(trim_filt, function(x){x[num_fact]})
if(length(trim_filt)>0){
save_logi <- unlist(lapply(sav_lst, function(x){
grepl("save", x["type"])
}))
rm_logi <- unlist(lapply(sav_lst, function(x){
grepl("rm", x["type"])
}))
sav_nam <- names(save_logi)[save_logi]
rm_nam <- names(rm_logi)[rm_logi]
if(length(sav_nam)>0){
save_logi <- rowSums(do.call("cbind", trim_filt[sav_nam])) > 0
sav_nam <- paste0(sav_nam, collapse="_")
fil_nam_un <- gsub("\\.trim.fastq.gz$",
paste0(".REMOVED_", sav_nam, ".fastq.gz"),
out_fl)
# append for chunks
if(is.null(chunk_size)){
ShortRead::writeFastq(fstq[save_logi], fil_nam_un,
mode="w", full=FALSE, compress=TRUE)
}else{
ShortRead::writeFastq(fstq[save_logi], fil_nam_un,
mode="a", full=FALSE, compress=TRUE)
}
}
if(length(rm_nam)>0){
rm_logi <- rowSums(do.call("cbind", trim_filt[rm_nam])) > 0
if(length(sav_nam)>0){
fstq <- fstq[!rowSums(cbind(rm_logi, save_logi)) > 0]
}else{
fstq <- fstq[!rm_logi]
}
}else{
fstq <- fstq[!save_logi]
}
}
rm(trim_filt, save_logi, rm_logi, num_fact)
gc(reset=TRUE)
########################
##### Size filter ######
if(!is.null(seq_range)){
logi_min <- Biostrings::width(fstq@sread) >= seq_range["min"]
logi_max <- Biostrings::width(fstq@sread) <= seq_range["max"]
sav_lst$size <- c(too_short=sum(!logi_min),
too_long=sum(!logi_max),
seq_range)
fstq <- fstq[logi_min+logi_max==2]
rm(logi_min, logi_max)
gc(reset=TRUE)
}
##########################################
##### Phred score quality filtering ######
# First extract trimmed qualities
if(!is.null(quality)){
enc <- Biostrings::encoding(fstq@quality) # Phred score translations
enc_srch <- as.factor(
names(enc))[paste0(enc) %in% as.character(seq.int(quality["threshold"]-1))]
enc_srch <- paste0("[", paste(enc_srch, collapse="") , "]")
# Apply filter if specified
qual_logi <- stringr::str_count(
paste0(Biostrings::quality(
fstq@quality)), enc_srch)
qual_logi <- 1-(qual_logi/Biostrings::width(
fstq@quality)) >= quality["percent"]
qual_logi[is.na(qual_logi)] <- FALSE
sav_lst$quality <- c(removed=sum(!qual_logi), quality)
fstq <- fstq[qual_logi]
rm(qual_logi)
gc(reset=TRUE)
}
##### Save fastq/chunks and return sav_lst for progress report #####
# Note, chunks should append to existing fq
sav_lst$out_reads <- length(fstq)
if(is.null(chunk_size)){
ShortRead::writeFastq(fstq, out_fl, mode="w",
full=FALSE, compress=TRUE)
}else{
ShortRead::writeFastq(fstq, out_fl, mode="a",
full=FALSE, compress=TRUE)
}
return(sav_lst)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.