plotMotifScores: Plot the raw motifs scores as returned by motifScores()
In PWMEnrich: PWM enrichment analysis

This function visualises the motif scores for one or more sequences. Sequences are drawn as lines, and scores are plotted as triangles at both sides of the line (corresponding to the two strands). The width of the base of the triangle corresponds to motif width and the height to the motif log(score) that is positive and greater than the cutoff parameter (if specified). All scores have the same y-axis, so the heights of bars are comparable between sequences and motifs.

plotMotifScores(
  scores,
  sel.motifs = NULL,
  seq.names = NULL,
  cols = NULL,
  cutoff = NULL,
  log.fun = log2,
  main = "",
  legend.space = 0.3,
  max.score = NULL,
  trans = 0.5,
  text.cex = 0.9,
  legend.cex = 0.9,
  motif.names = NULL,
  seq.len.spacing = 8,
  shape = "rectangle"
)

`scores`	the list of motifs scores. Each element of the list is a matrix of scores for one sequences. The columns in the matrix correspond to different motifs. Each column contains the odds (not log-odds!) scores over both strands. For example, for a sequence of length 5, scores for a 3 bp motifs could be: `c(0.1, 1, 4, NA, NA, 1, 0.3, 2, NA, NA)`. The first 3 numbers are odds scores starting at first three bases, and the second lot of 3 numbers is the scores starting at the same positions but with the reverse complement of the motif. The last two values are NA on both strands because we do not support partial motif hits.
`sel.motifs`	a vector of motif names. Use this parameter to show the motif hits to only a subset of motifs for which the scores are available.
`seq.names`	a vector of sequence names to show in the graph. If none specified, the sequences will be named Sequence 1, Sequence 2, ...
`cols`	a vector of colours to use to colour code motif hits. If none are specified, the current palette will be used.
`cutoff`	either a single value, or a vector of values. The values are PWM cutoffs after `log.fun` (see below). Only motif scores above these cutoffs will be shown. If a single values is specified, it will be used for all PWMs, otherwise the vector needs to specify one cutoff per PWM.
`log.fun`	the logarithm function to use to calculate log-odds. By default log2 is used for consistency with Biostrings.
`main`	the main title
`legend.space`	the proportion of horizontal space to reserve for the legend. The default is 30%.
`max.score`	the maximal log-odds score used to scale all other scores. By default this values is automatically determined, but it can also be set manually to make multiple plots comparable.
`trans`	the level of transparency. By default 50% transparency to be able to see overlapping binding sites
`text.cex`	the scaling factor for sequence names
`legend.cex`	the scaling factor for the legend
`motif.names`	optional vector of motif names to show instead of those present as column names in `scores`
`seq.len.spacing`	the spacing (in bp units) between the end of the sequence line and the text showing the length in bp
`shape`	the shape to use to draw motif occurances, valid values are "rectangle" (default), "line" and "triangle"

if(requireNamespace("PWMEnrich.Dmelanogaster.background")){
   ###
   # Load Drosophila PWMs
   data(MotifDb.Dmel, package = "PWMEnrich.Dmelanogaster.background")

   # two sequences of interest
   sequences = list(DNAString("GAAGTATCAAGTGACCAGGTGAAGTCCCAGATGA"), 
     DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))

   # select the tinman and snail motifs
   pwms = MotifDb.Dmel[c("tin", "sna")]

   # get the raw score that will be plotted
   scores = motifScores(sequences, pwms, raw.scores=TRUE)

   # plot the scores in both sequences, green for tin and blue for sna
   plotMotifScores(scores, cols=c("green", "blue"))
    
}