Nothing
# Amino acid sequence properties
#### Chemical property functions ####
#' Calculates the average bulkiness of amino acid sequences
#'
#' \code{bulk} calculates the average bulkiness score of amino acid sequences.
#' Non-informative positions are excluded, where non-informative is defined as any
#' character in \code{c("X", "-", ".", "*")}.
#'
#' @param seq vector of strings containing amino acid sequences.
#' @param bulkiness named numerical vector defining bulkiness scores for
#' each amino acid, where names are single-letter amino acid
#' character codes. If \code{NULL}, then the Zimmerman et al, 1968
#' scale is used.
#'
#' @return A vector of bulkiness scores for the sequence(s).
#'
#' @references
#' \enumerate{
#' \item Zimmerman JM, Eliezer N, Simha R. The characterization of amino acid sequences
#' in proteins by statistical methods. J Theor Biol 21, 170-201 (1968).
#' }
#' @seealso
#' For additional size related indices see \link[seqinr]{aaindex}.
#'
#' @examples
#' # Default bulkiness scale
#' seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
#' bulk(seq)
#'
#' # Use the Grantham, 1974 side chain volumn scores from the seqinr package
#' library(seqinr)
#' data(aaindex)
#' x <- aaindex[["GRAR740103"]]$I
#' # Rename the score vector to use single-letter codes
#' names(x) <- translateStrings(names(x), ABBREV_AA)
#' # Calculate average volume
#' bulk(seq, bulkiness=x)
#'
#' @export
bulk <- function(seq, bulkiness=NULL) {
# Get bulkiness scores
if (is.null(bulkiness)) {
bulkiness <- BULKINESS_ZIMJ68
}
# Remove non-informative positions
seq <- gsub("[X\\.\\*-]", "", as.character(seq))
# Create character vector from string
aa <- strsplit(seq, "")
# Calculate average bulkiness
aa_bulk <- sapply(aa, function(x) sum(bulkiness[x]) / length(x))
return(aa_bulk)
}
#' Calculates the average polarity of amino acid sequences
#'
#' \code{polar} calculates the average polarity score of amino acid sequences.
#' Non-informative positions are excluded, where non-informative is defined as any
#' character in \code{c("X", "-", ".", "*")}.
#'
#' @param seq vector of strings containing amino acid sequences.
#' @param polarity named numerical vector defining polarity scores for
#' each amino acid, where names are single-letter amino acid
#' character codes. If \code{NULL}, then the Grantham, 1974
#' scale is used.
#'
#' @return A vector of bulkiness scores for the sequence(s).
#'
#' @references
#' \enumerate{
#' \item Grantham R. Amino acid difference formula to help explain protein evolution.
#' Science 185, 862-864 (1974).
#' }
#' @seealso
#' For additional size related indices see \code{\link[seqinr]{aaindex}}.
#'
#' @examples
#' # Default scale
#' seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
#' polar(seq)
#'
#' # Use the Zimmerman et al, 1968 polarity scale from the seqinr package
#' library(seqinr)
#' data(aaindex)
#' x <- aaindex[["ZIMJ680103"]]$I
#' # Rename the score vector to use single-letter codes
#' names(x) <- translateStrings(names(x), ABBREV_AA)
#' # Calculate polarity
#' polar(seq, polarity=x)
#'
#' @export
polar <- function(seq, polarity=NULL) {
# Get bulkiness scores
if (is.null(polarity)) {
polarity <- POLARITY_GRAR74
}
# Remove non-informative positions
seq <- gsub("[X\\.\\*-]", "", as.character(seq))
# Create character vector from string
aa <- strsplit(seq, "")
# Calculate average polarity
aa_polar <- sapply(aa, function(x) sum(polarity[x]) / length(x))
return(aa_polar)
}
#' Calculates the hydrophobicity of amino acid sequences
#'
#' \code{gravy} calculates the Grand Average of Hydrophobicity (gravy) index
#' of amino acid sequences using the method of Kyte & Doolittle. Non-informative
#' positions are excluded, where non-informative is defined as any character in
#' \code{c("X", "-", ".", "*")}.
#'
#' @param seq vector of strings containing amino acid sequences.
#' @param hydropathy named numerical vector defining hydropathy index values for
#' each amino acid, where names are single-letter amino acid
#' character codes. If \code{NULL}, then the Kyte & Doolittle
#' scale is used.
#'
#' @return A vector of gravy scores for the sequence(s).
#'
#' @references
#' \enumerate{
#' \item Kyte J, Doolittle RF. A simple method for displaying the hydropathic character
#' of a protein. J Mol Biol. 157, 105-32 (1982).
#' }
#' @seealso
#' For additional hydrophobicity indices see \code{\link[seqinr]{aaindex}}.
#'
#' @examples
#' # Default scale
#' seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
#' gravy(seq)
#'
#' # Use the Kidera et al, 1985 scores from the seqinr package
#' library(seqinr)
#' data(aaindex)
#' x <- aaindex[["KIDA850101"]]$I
#' # Rename the score vector to use single-letter codes
#' names(x) <- translateStrings(names(x), ABBREV_AA)
#' # Calculate hydrophobicity
#' gravy(seq, hydropathy=x)
#'
#' @export
gravy <- function(seq, hydropathy=NULL) {
# Get hydrophobicity scores
if (is.null(hydropathy)) {
hydropathy <- HYDROPATHY_KYTJ82
}
# Remove non-informative positions
seq <- gsub("[X\\.\\*-]", "", as.character(seq))
# Create character vector from string
aa <- strsplit(seq, "")
# Calculate gravy
aa_gravy <- sapply(aa, function(x) sum(hydropathy[x]) / length(x))
return(aa_gravy)
}
#' Calculates the aliphatic index of amino acid sequences
#'
#' \code{aliphatic} calculates the aliphatic index of amino acid sequences using
#' the method of Ikai. Non-informative positions are excluded, where non-informative
#' is defined as any character in \code{c("X", "-", ".", "*")}.
#'
#' @param seq vector of strings containing amino acid sequences.
#' @param normalize if \code{TRUE} then divide the aliphatic index of each amino acid
#' sequence by the number of informative positions. Non-informative
#' position are defined by the presence any character in
#' \code{c("X", "-", ".", "*")}. If \code{FALSE} then return the raw
#' aliphatic index.
#'
#' @return A vector of the aliphatic indices for the sequence(s).
#'
#' @references
#' \enumerate{
#' \item Ikai AJ. Thermostability and aliphatic index of globular proteins.
#' J Biochem. 88, 1895-1898 (1980).
#' }
#'
#' @examples
#' seq <- c("CARDRSTPWRRGIASTTVRTSW", NA, "XXTQMYVRT")
#' aliphatic(seq)
#'
#' @export
aliphatic <- function(seq, normalize=TRUE) {
# Calculate aliphatic index for valid amino acids
ala <- countOccurrences(seq, "[A]")
val <- countOccurrences(seq, "[V]")
leu_ile <- countOccurrences(seq, "[LI]")
aa_aliphatic = ala + 2.9 * val + 3.9 * leu_ile
if (normalize) {
aa_aliphatic <- aa_aliphatic / stri_length(gsub("[X\\.\\*-]", "", seq))
}
return(aa_aliphatic)
}
#' Calculates the net charge of amino acid sequences.
#'
#' \code{charge} calculates the net charge of amino acid sequences using
#' the method of Moore, 1985, with exclusion of the C-terminus and N-terminus charges.
#'
#' @param seq vector strings defining of amino acid sequences.
#' @param pH environmental pH.
#' @param pK named vector defining pK values for each charged amino acid,
#' where names are the single-letter amino acid character codes
#' \code{c("R", "H", "K", "D", "E", "C", "Y")}). If \code{NULL},
#' then the EMBOSS scale is used.
#' @param normalize if \code{TRUE} then divide the net charge of each amino acid
#' sequence by the number of informative positions. Non-informative
#' position are defined by the presence any character in
#' \code{c("X", "-", ".", "*")}. If \code{FALSE} then return the raw
#' net charge.
#'
#' @return A vector of net charges for the sequence(s).
#'
#' @references
#' \enumerate{
#' \item Moore DS. Amino acid and peptide net charges: A simple calculational procedure.
#' Biochem Educ. 13, 10-11 (1985).
#' \item \url{https://emboss.sourceforge.net/apps/cvs/emboss/apps/iep.html}
#' }
#'
#' @seealso
#' For additional pK scales see \code{\link[seqinr]{pK}}.
#'
#' @examples
#' seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
#' # Unnormalized charge
#' charge(seq)
#' # Normalized charge
#' charge(seq, normalize=TRUE)
#'
#' # Use the Murray et al, 2006 scores from the seqinr package
#' library(seqinr)
#' data(pK)
#' x <- setNames(pK[["Murray"]], rownames(pK))
#' # Calculate charge
#' charge(seq, pK=x)
#'
#' @export
charge <- function(seq, pH=7.4, pK=NULL, normalize=FALSE) {
# Get charge data
if(is.null(pK)) {
pK <- PK_EMBOSS
}
# Calculate charge
arg <- countOccurrences(seq, "R") * (1/(1 + 10^(1 * (pH - pK["R"]))))
his <- countOccurrences(seq, "H") * (1/(1 + 10^(1 * (pH - pK["H"]))))
lys <- countOccurrences(seq, "K") * (1/(1 + 10^(1 * (pH - pK["K"]))))
asp <- countOccurrences(seq, "D") * (-1/(1 + 10^(-1 * (pH - pK["D"]))))
glu <- countOccurrences(seq, "E") * (-1/(1 + 10^(-1 * (pH - pK["E"]))))
cys <- countOccurrences(seq, "C") * (-1/(1 + 10^(-1 * (pH - pK["C"]))))
tyr <- countOccurrences(seq, "Y") * (-1/(1 + 10^(-1 * (pH - pK["Y"]))))
aa_charge <- arg + lys + his + asp + glu + tyr + cys
if (normalize) {
aa_charge <- aa_charge / stri_length(gsub("[X\\.\\*-]", "", seq))
}
return(aa_charge)
}
#' Validate amino acid sequences
#'
#' \code{isValidAASeq} checks that a set of sequences are valid non-ambiguous
#' amino acid sequences. A sequence is considered valid if it contains only
#' characters in the the non-ambiguous IUPAC character set or any characters in
#' \code{c("X", ".", "-", "*")}.
#'
#' @param seq character vector of sequences to check.
#'
#' @return A logical vector with \code{TRUE} for each valid amino acid sequences
#' and \code{FALSE} for each invalid sequence.
#' @seealso
#' See \link{ABBREV_AA} for the set of non-ambiguous amino acid characters.
#' See \link{IUPAC_AA} for the full set of ambiguous amino acid characters.
#'
#' @examples
#' seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVR--XX", "CARJ", "10")
#' isValidAASeq(seq)
#'
#' @export
isValidAASeq <- function(seq) {
# Get valid amino acids from seqinr
# for consistency with `gravy` and other
# amino acid properties that don't consider
# amino acid ambiguities and special encoded amino acids
# http://pir.georgetown.edu/resid/faq.shtml#q01
# Also include here characters for non informative positions
valid_AA <- c(names(ABBREV_AA), "X", ".", "*", "-")
.isValid <- function(aa) {
all(aa %in% valid_AA)
}
return(sapply(strsplit(seq, ""), .isValid))
# valid_AA <- paste(c(names(ABBREV_AA),"X.*-"),collapse="")
# valid <- !grepl(paste0("[^",valid_AA,"]"), seq) & !is.na(seq)
# valid
}
# Count patterns
#
# Counts the number of times a "pattern" occurs in "x", a string
#
# @param x a string (usually amino acids)
# @param pattern regular expression to be matched in string
#
# @return number of times the regular expression was found
countOccurrences <- function(x, pattern) {
return(sapply(gregexpr(pattern, x), function(y) { sum(y > 0) }))
}
#' Count sequence patterns
#'
#' \code{countPatterns} counts the fraction of times a set of character patterns occur
#' in a set of sequences.
#'
#' @param seq character vector of either DNA or amino acid sequences.
#' @param patterns list of sequence patterns to count in each sequence. If the
#' list is named, then names will be assigned as the column names of
#' output data.frame.
#' @param nt if \code{TRUE} then \code{seq} are DNA sequences and and will be
#' translated before performing the pattern search.
#' @param trim if \code{TRUE} remove the first and last codon or amino acid from
#' each sequence before the pattern search. If \code{FALSE} do
#' not modify the input sequences.
#' @param label string defining a label to add as a prefix to the output
#' column names.
#'
#' @return A data.frame containing the fraction of times each sequence pattern was
#' found.
#'
#' @examples
#' seq <- c("TGTCAACAGGCTAACAGTTTCCGGACGTTC",
#' "TGTCAGCAATATTATATTGCTCCCTTCACTTTC",
#' "TGTCAAAAGTATAACAGTGCCCCCTGGACGTTC")
#' patterns <- c("A", "V", "[LI]")
#' names(patterns) <- c("arg", "val", "iso_leu")
#' countPatterns(seq, patterns, nt=TRUE, trim=TRUE, label="cdr3")
#'
#' @export
countPatterns <- function(seq, patterns, nt=TRUE, trim=FALSE, label="region") {
# Translate sequences if nucleotide
region_aa <- if (nt) { translateDNA(seq, trim=trim) } else { seq }
# TODO: What is the proper length normalization? With or without non-informative position?
# Calculate region lengths
aa_length <- stri_length(region_aa)
# Count occurrence of each amino acid pattern for each sequence
out_df <- data.frame(matrix(0, nrow=length(region_aa), ncol=length(patterns)))
# If patterns are unnamed, make the names X1...Xn
if(is.null(names(patterns))) { names(patterns) <- names(out_df) }
# If region name, append to names of patterns
if(label != '') {
names(out_df) <- paste(label, names(patterns), sep="_")
} else {
names(out_df) <- names(patterns)
}
# Iterate over patterns
for(i in 1:length(patterns)) {
out_df[, i] <- countOccurrences(region_aa, patterns[i]) / aa_length
}
return(out_df)
}
#' Calculates amino acid chemical properties for sequence data
#'
#' \code{aminoAcidProperties} calculates amino acid sequence physicochemical properties, including
#' length, hydrophobicity, bulkiness, polarity, aliphatic index, net charge, acidic residue
#' content, basic residue content, and aromatic residue content.
#'
#' @param data \code{data.frame} containing sequence data.
#' @param property vector strings specifying the properties to be calculated. Defaults
#' to calculating all defined properties.
#' @param seq \code{character} name of the column containing input
#' sequences.
#' @param nt boolean, TRUE if the sequences (or sequence) are DNA and will be translated.
#' @param trim if \code{TRUE} remove the first and last codon/amino acids from each
#' sequence before calculating properties. If \code{FALSE} do
#' not modify input sequences.
#' @param label name of sequence region to add as prefix to output column names.
#' @param ... additional named arguments to pass to the functions
#' \link{gravy}, \link{bulk}, \link{aliphatic}, \link{polar} or \link{charge}.
#'
#' @return A modified \code{data} data.frame with the following columns:
#' \itemize{
#' \item \code{*_aa_length}: number of amino acids.
#' \item \code{*_aa_gravy}: grand average of hydrophobicity (gravy) index.
#' \item \code{*_aa_bulk}: average bulkiness of amino acids.
#' \item \code{*_aa_aliphatic}: aliphatic index.
#' \item \code{*_aa_polarity}: average polarity of amino acids.
#' \item \code{*_aa_charge}: net charge.
#' \item \code{*_aa_basic}: fraction of informative positions that are
#' Arg, His or Lys.
#' \item \code{*_aa_acidic}: fraction of informative positions that are
#' Asp or Glu.
#' \item \code{*_aa_aromatic}: fraction of informative positions that are
#' His, Phe, Trp or Tyr.
#'
#' }
#'
#' Where \code{*} is the value from \code{label} or the name specified for
#' \code{seq} if \code{label=NULL}.
#'
#' @details
#' For all properties except for length, non-informative positions are excluded,
#' where non-informative is defined as any character in \code{c("X", "-", ".", "*")}.
#'
#' The scores for gravy, bulkiness and polarity are calculated as simple averages of the
#' scores for each informative positions. The basic, acid and aromatic indices are
#' calculated as the fraction of informative positions falling into the given category.
#'
#' The aliphatic index is calculated using the Ikai, 1980 method.
#'
#' The net charge is calculated using the method of Moore, 1985, excluding the N-terminus and
#' C-terminus charges, and normalizing by the number of informative positions. The default
#' pH for the calculation is 7.4.
#'
#' The following data sources were used for the default property scores:
#' \itemize{
#' \item hydropathy: Kyte & Doolittle, 1982.
#' \item bulkiness: Zimmerman et al, 1968.
#' \item polarity: Grantham, 1974.
#' \item pK: EMBOSS.
#' }
#'
#' @references
#' \enumerate{
#' \item Zimmerman JM, Eliezer N, Simha R. The characterization of amino acid sequences
#' in proteins by statistical methods. J Theor Biol 21, 170-201 (1968).
#' \item Grantham R. Amino acid difference formula to help explain protein evolution.
#' Science 185, 862-864 (1974).
#' \item Ikai AJ. Thermostability and aliphatic index of globular proteins.
#' J Biochem 88, 1895-1898 (1980).
#' \item Kyte J, Doolittle RF. A simple method for displaying the hydropathic character
#' of a protein. J Mol Biol 157, 105-32 (1982).
#' \item Moore DS. Amino acid and peptide net charges: A simple calculational procedure.
#' Biochem Educ 13, 10-11 (1985).
#' \item Wu YC, et al. High-throughput immunoglobulin repertoire analysis distinguishes
#' between human IgM memory and switched memory B-cell populations.
#' Blood 116, 1070-8 (2010).
#' \item Wu YC, et al. The relationship between CD27 negative and positive B cell
#' populations in human peripheral blood.
#' Front Immunol 2, 1-12 (2011).
#' \item \url{https://emboss.sourceforge.net/apps/cvs/emboss/apps/iep.html}
#' }
#'
#' @seealso
#' See \link{countPatterns} for counting the occurrence of specific amino acid subsequences.
#' See \link{gravy}, \link{bulk}, \link{aliphatic}, \link{polar} and \link{charge} for functions
#' that calculate the included properties individually.
#'
#' @examples
#' # Subset example data
#' db <- ExampleDb[c(1,10,100), c("sequence_id", "junction")]
#'
#' # Calculate default amino acid properties from DNA sequences
#' aminoAcidProperties(db, seq="junction")
#
#' # Calculate default amino acid properties from amino acid sequences
#' # Use a custom output column prefix
#' db$junction_aa <- translateDNA(db$junction)
#' aminoAcidProperties(db, seq="junction_aa", label="junction", nt=FALSE)
#'
#' # Use the Grantham, 1974 side chain volume scores from the seqinr package
#' # Set pH=7.0 for the charge calculation
#' # Calculate only average volume and charge
#' # Remove the head and tail amino acids from the junction, thus making it the CDR3
#' library(seqinr)
#' data(aaindex)
#' x <- aaindex[["GRAR740103"]]$I
#' # Rename the score vector to use single-letter codes
#' names(x) <- translateStrings(names(x), ABBREV_AA)
#' # Calculate properties
#' aminoAcidProperties(db, property=c("bulk", "charge"), seq="junction",
#' trim=TRUE, label="cdr3", bulkiness=x, pH=7.0)
#'
#' @export
aminoAcidProperties <- function(data, property=c("length", "gravy", "bulk",
"aliphatic","polarity","charge",
"basic","acidic", "aromatic"),
seq="junction", nt=TRUE, trim=FALSE, label=NULL, ...) {
# Check arguments
property <- match.arg(property, several.ok=TRUE)
# Define the data.frame that will be returned with amino acid properties
prop_colnames <- list(
"length" = "aa_length",
"gravy" = "aa_gravy",
"bulk" = "aa_bulk",
"aliphatic" = "aa_aliphatic",
"polarity" = "aa_polarity",
"charge" = "aa_charge",
"basic" = "aa_basic",
"acidic" = "aa_acidic",
"aromatic" = "aa_aromatic"
)
# If no label, use sequence column name
if (is.null(label)) { label <- seq }
prop_colnames <- lapply(prop_colnames, function(x) { paste(label,x,sep="_") })
out_df <- data.frame(matrix(NA, nrow=nrow(data), ncol=length(property)))
colnames(out_df) <- prop_colnames[property]
# Check if out_df column names already existed in data
# if yes, throw warning
check <- checkColumns(data, colnames(out_df))
if (any(check == TRUE)) { warning("Duplicated columns found. Overwriting previous values.")}
# Check input
if (length(seq) > 1) {
stop("You may specify only one sequence column; seq must be a vector of length 1.")
}
check <- checkColumns(data, seq)
if (check != TRUE) { stop(check) }
# Assign ellipsis arguments to correct function
dots <- list(...)
args_gravy <- dots[names(dots) %in% names(formals(gravy))]
args_bulk <- dots[names(dots) %in% names(formals(bulk))]
args_aliphatic <- dots[names(dots) %in% names(formals(aliphatic))]
args_polar <- dots[names(dots) %in% names(formals(polar))]
args_charge <- dots[names(dots) %in% names(formals(charge))]
# Get sequence vector and translate if required
region <- as.character(data[[seq]])
region_aa <- if (nt) {
translateDNA(region, trim=trim)
} else {
if (trim) {
region <- substr(region, 2, stri_length(region) - 1)
}
region
}
## Will retrieve properties for valid sequences only
## keep index to fill results data.frame
valid_seq <- isValidAASeq(region_aa)
if (any(valid_seq == F) ){
not_valid_num <- sum(!valid_seq)
warning(paste0("Found ", not_valid_num , " sequences with non valid amino acid symbols"))
}
valid_seq_idx <- which(valid_seq)
region_aa <- region_aa[valid_seq_idx]
# Calculate region lengths
if ("length" %in% property) {
aa_length <- stri_length(region_aa)
out_df[valid_seq_idx , prop_colnames$length] <- aa_length
}
# Average hydrophobicity
if ("gravy" %in% property) {
#aa_gravy <- gravy(region_aa, hydropathy)
aa_gravy <- do.call('gravy', c(list(seq=region_aa), args_gravy))
out_df[valid_seq_idx , prop_colnames$gravy] <- aa_gravy
}
# Average bulkiness
if ("bulk" %in% property) {
#aa_bulk <- bulk(region_aa)
aa_bulk <- do.call('bulk', c(list(seq=region_aa), args_bulk))
out_df[valid_seq_idx , prop_colnames$bulk] <- aa_bulk
}
if ("aliphatic" %in% property) {
# Normalizes aliphatic index
aa_aliphatic <- do.call('aliphatic', c(list(seq=region_aa), args_aliphatic))
out_df[valid_seq_idx , prop_colnames$aliphatic] <- aa_aliphatic
}
# Average polarity
if ("polarity" %in% property) {
#aa_polarity <- polar(region_aa)
aa_polarity <- do.call('polar', c(list(seq=region_aa), args_polar))
out_df[valid_seq_idx , prop_colnames$polarity] <- aa_polarity
}
# Normalized net charge
if ("charge" %in% property) {
#aa_charge <- charge(region_aa)
aa_charge <- do.call('charge', c(list(seq=region_aa), args_charge))
out_df[valid_seq_idx , prop_colnames$charge] <- aa_charge
}
# Count of informative positions
aa_info <- stri_length(gsub("[X\\.\\*-]", "", region_aa))
# Fraction of amino acid that are basic
if ("basic" %in% property) {
aa_basic <- countOccurrences(region_aa, "[RHK]") / aa_info
out_df[valid_seq_idx , prop_colnames$basic] <- aa_basic
}
# Fraction of amino acid that are acidic
if ("acidic" %in% property) {
aa_acidic <- countOccurrences(region_aa, "[DE]") / aa_info
out_df[valid_seq_idx , prop_colnames$acidic] <- aa_acidic
}
# Count fraction of aa that are aromatic
if ("aromatic" %in% property) {
aa_aromatic <- countOccurrences(region_aa, "[FWHY]") / aa_info
out_df[valid_seq_idx , prop_colnames$aromatic] <- aa_aromatic
}
data_cols <- colnames(data) %in% colnames(out_df) == FALSE
return(cbind(data[, data_cols], out_df))
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.