context("Primer coverage")
test_that("Stop codon filter", {
# test coverage stop codon filter
data(Ippolito)
template.df <- template.df[1:3,]
# reading frame: aga|tac|...
# note: third seq has already a stop codon at 'taa' -> coverage events
# with 'taa' are ok!
template.df$InputSequence <- c("agatacacccccccccccccc",
"agatacagattacagattaca",
"agataaagattacagattaca")
template.df <- assign_binding_regions(template.df, fw = c(1,14), rev = c(1,5))
stop.codons <- c("TAG", "TAA", "TGA")
# first primer has gaTAGa: should bind to 1st, 2nd, 3rd with stop codon
# second primer has gaTAAa: should bind to 1st, 2nd, 3rd with stop codon
# third primer has gaTGA: should bind to the third template with stop codon
seqs <- c("gataga", "gataaa", "gatgaa")
fname <- tempfile("test.fasta")
seqinr::write.fasta(as.list(seqs), as.list(c("testPrimer1_fw", "testPrimer2_fw", "testPrimer3_fw")), fname)
primer.df <- read_primers(fname)
# allow a single mismatch to introduce stop codons
conOptions(settings)$allowed_mismatches <- 1
# do not use any additional cvg constraints:
cvg_constraints(settings) <- list()
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
#######
#mutation.types <- c("stop_codon")
#mutation.check <- mismatch.mutation.check(constraint.df, template.df, mutation.types)
###
expect_that(constraint.df$primer_coverage,
equals(c(3, 3, 1), tolerance = 0.0))
expect_that(constraint.df$primer_specificity,
equals(c(1, 1, 1), tolerance = 0.01))
# now, add stop codon constraint to filter out stop codon events
cvg_constraints(settings) <- list("stop_codon" = c("min" = 0, "max" = 0))
constraint.df <- suppressWarnings(check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage"))
# all primers can bind the third template with 1 mismatch:
# binding is ok since 'taa' is already a stop codon in the template
# and no additional stop codon is introduced!
expect_that(constraint.df$primer_coverage,
equals(c(1, 1, 1), tolerance = 0.0))
})
test_that("Free energy filter", {
# check whether binding events are filtered correctly according to their free energies
if (!check.tool.function()["OligoArrayAux"]) {
# cannot test without OligoArrayAux
skip("OligoArrayAux not available.")
}
data(Ippolito)
primer.df <- primer.df[1:2,]
# get baseline results if we don't filter
cvg_constraints(settings) <- list("annealing_DeltaG" = c("max" = 0)) # no filtering
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
# decide for a cutoff:
deltaG.cutoff <- -15 # everything greater than -15 should be filtered
# retrieve observed values
deltaG.values <- lapply(strsplit(constraint.df$annealing_DeltaG, split = ","), as.numeric)
sel.idx <- lapply(deltaG.values, function(x) which(x <= deltaG.cutoff))
filtered.cvd.seqs <- sapply(seq_along(sel.idx), function(x) paste0(strsplit(constraint.df$Covered_Seqs[x], split = ",")[[1]][sel.idx[[x]]], collapse = ","))
filtered.cvg <- sapply(sel.idx, length)
# determine results from tool:
cvg_constraints(settings) <- list("annealing_DeltaG" = c("max" = deltaG.cutoff)) # filter!
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
expect_equal(filtered.cvg, constraint.df$primer_coverage)
expect_equal(filtered.cvd.seqs, constraint.df$Covered_Seqs)
})
test_that("Efficiency Filter", {
# check whether binding events are filtered correctly according to their efficiencies
if (!check.tool.function()["OligoArrayAux"]) {
# cannot test without OligoArrayAux
skip("OligoArrayAux not available.")
}
data(Ippolito)
primer.df <- primer.df[1:2,]
# get baseline results if we don't filter
cvg_constraints(settings) <- list("primer_efficiency" = c("min" = 0)) # no filtering
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
# decide for a cutoff:
eff.cutoff <- 0.1 # everything smalelr than 0.1 efficiency should be filtered
# retrieve observed values
eff.values <- lapply(strsplit(constraint.df$primer_efficiency, split = ","), as.numeric)
sel.idx <- lapply(eff.values, function(x) which(x >= eff.cutoff))
filtered.cvd.seqs <- sapply(seq_along(sel.idx), function(x) paste0(strsplit(constraint.df$Covered_Seqs[x], split = ",")[[1]][sel.idx[[x]]], collapse = ","))
filtered.cvg <- sapply(sel.idx, length)
# determine results from tool:
cvg_constraints(settings) <- list("primer_efficiency" = c("min" = eff.cutoff)) # filter
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
expect_equal(filtered.cvg, constraint.df$primer_coverage)
expect_equal(filtered.cvd.seqs, constraint.df$Covered_Seqs)
})
test_that("3prime mismatches", {
# check filtering for mismatches at the 3' ends
data(Ippolito)
primer.df <- primer.df[1:2,]
# get baseline results if we don't filter
cvg_constraints(settings) <- list("terminal_mismatch_pos" = c("min" = 0)) # no filtering
conOptions(settings)$allowed_mismatches <- 3
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
# decide for a cutoff:
terminal.cutoff <- 6 # everything smalelr than 0.1 efficiency should be filtered
# retrieve observed values
terminal.pos <- lapply(strsplit(constraint.df$terminal_mismatch_pos, split = ","), as.numeric)
sel.idx <- lapply(terminal.pos, function(x) which(x >= terminal.cutoff))
filtered.cvd.seqs <- sapply(seq_along(sel.idx), function(x) paste0(strsplit(constraint.df$Covered_Seqs[x], split = ",")[[1]][sel.idx[[x]]], collapse = ","))
filtered.cvg <- sapply(sel.idx, length)
# determine results from tool:
cvg_constraints(settings) <- list("terminal_mismatch_pos" = c("min" = terminal.cutoff)) # filter
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
expect_equal(filtered.cvg, constraint.df$primer_coverage)
expect_equal(filtered.cvd.seqs, constraint.df$Covered_Seqs)
})
test_that("basic_coverage", {
# check that basic reported coverage is correct:
# position of binding
# mismatch positions
# number of mismatches
# covered seqs
# coverage count
data(Ippolito)
primer.df <- primer.df[1:2,]
template.df <- template.df[template.df$Identifier %in% c(4,5,8,9)]
cvg_constraints(settings) <- list() # no advanced cvg requirements
conOptions(settings)$allowed_mismatches <- 0
constraint.df <- check_constraints(primer.df, template.df, settings,
active.constraints = "primer_coverage")
expect_equal(constraint.df$primer_coverage, c(2,2))
expect_equal(constraint.df$Coverage_Ratio, c(0.5,0.5))
expect_equal(constraint.df$Nbr_of_mismatches_fw, c("0,0", "0,0"))
expect_equal(constraint.df$Binding_Position_Start_fw, c("58,58", "58,58"))
expect_equal(constraint.df$Binding_Position_End_fw, c("80,80", "80,80"))
cvg_constraints(settings) <- list("terminal_mismatch_pos" = c(min = 6))
})
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.