####
# Actions to perform on loading/attaching the package
######
#' @import ggplot2 lpSolveAPI methods
#' @importFrom reshape2 melt dcast
#' @importFrom plyr ddply summarize arrange . here catcolwise rbind.fill numcolwise
#' @importFrom foreach foreach %dopar% getDoParRegistered getDoParWorkers
#' @importFrom IRanges IRanges as.matrix Views findOverlaps overlapsAny CharacterList
#' @importFrom Biostrings DNAStringSet IUPAC_CODE_MAP extractAt reverseComplement mergeIUPACLetters DNAStringSetList vmatchPattern matchPattern width DNA_BASES
#' @importFrom pwalign nucleotideSubstitutionMatrix pairwiseAlignment mismatch compareStrings
#' @importFrom RColorBrewer brewer.pal
#' @importFrom grDevices colorRampPalette
#' @importFrom S4Vectors metadata metadata<-
#' @importFrom BiocGenerics unlist start end
#' @importFrom magrittr %>%
#' @importFrom stats na.omit qnorm quantile sd ave fisher.test p.adjust as.formula reshape predict hclust
#' @importFrom utils head read.csv read.delim setTxtProgressBar tail txtProgressBar write.csv write.table
#' @importFrom GenomicRanges GRanges
NULL # need to have some evaluated code here
#' Determination if Selenium is installed.
#'
#' Checks whether selenium module for python is installed on the system.
#'
#' @return \code{TRUE} is selenium for python is available,
#' \code{FALSE} otherwise.
#'
#' @keywords internal
selenium.installed <- function() {
if (Sys.which("python") == "") {
# python not available
return(FALSE)
}
cmd <- "python -c 'import selenium'"
ret <- system(cmd, ignore.stdout = TRUE, ignore.stderr = TRUE)
if (ret == 0) {
# installed
return(TRUE)
} else {
return(FALSE)
}
}
#' Check Tool Installation
#'
#' Checks whether all required tools are installed.
#'
#' @param frontend Whether tool installation shall be checked for the frontend.
#' If \code{TRUE}, dependencies that are required only by the frontend are considered additionally.
#' @return \code{TRUE} for each installed tool, \code{FALSE} otherwise.
#' @keywords internal
check.tool.installation <- function(frontend = FALSE) {
available.tools <- NULL
# for melting temperatures
available.tools["MELTING"] <- Sys.which("melting-batch") != ""
# for secondary structures
available.tools["ViennaRNA"] <- Sys.which("RNAfold") != ""
# for DECIPHER
available.tools["OligoArrayAux"] <- Sys.which("hybrid-min") != ""
# for multiple sequence alignments
available.tools["MAFFT"] <- Sys.which("mafft") != ""
available.tools["Pandoc"] <- Sys.which("pandoc") != ""
## for IMGT data retrieval in frontend
if (frontend) {
available.tools["Selenium"] <- selenium.installed()
available.tools["PhantomJS"] <- Sys.which("phantomjs") != ""
}
return(available.tools)
}
#' Check Functionality of Third-Party Tools.
#'
#' Checks whether all required tools should work.
#'
#' @param frontend Whether tool functionality shall be checked for the frontend.
#' @return \code{TRUE} for each functioning tool, \code{FALSE} for non-functioning tools.
#' @keywords internal
check.tool.function <- function(frontend = FALSE) {
available.tools <- check.tool.installation(frontend)
out <- NULL
# check for oligoArrayAux
if (available.tools["OligoArrayAux"]) {
try(out <- system("hybrid-min -n DNA -t 50 -T 50 -N 0.05 -E -q ACAGGTGCCCACTCCCAGGTGCAG CTGCACCTGGGAGTGGGCACCTGT",
intern = FALSE, ignore.stdout = TRUE))
if (out != 0) {
# there was an error
warning("oligoArrayAux failed checks: disabled. Do you have the UNAFOLDDAT environment variable set?")
available.tools["OligoArrayAux"] <- FALSE
}
}
# check for Pandoc/Latex
if (available.tools["Pandoc"] && Sys.which("pdflatex") == "") {
# don't warn here, otherwise too many warnings are generated
#warning("Cannot create reports with pandoc since LateX is missing.")
available.tools["Pandoc"] <- FALSE
}
# check for ViennaRNA version
if (available.tools["ViennaRNA"]) {
# need to require a specific version (2.4.1) of viennaRNA for support of the used commands
version <- NULL
try (version <- system2("RNAfold", "--version", stdout = TRUE, stderr = TRUE))
if (!is(version, "try-error")) {
# the command worked -> check the version string
v <- strsplit(version, " ")[[1]]
if (length(v) >= 2) {
nbr <- try(as.numeric(gsub("\\.", "", v[2])))
if (!is(nbr, "try-error")) {
if (nbr < 241) { # version smaller than 2.4.1
warning("ViennaRNA had version < 2.4.1. Disabling ViennaRNA.")
available.tools["ViennaRNA"] <- FALSE
}
} else {
warning("ViennaRNA version unknown. Disabling.")
available.tools["ViennaRNA"] <- FALSE # unknown version
}
} else {
warning("ViennaRNA version unknown. Disabling")
available.tools["ViennaRNA"] <- FALSE # unknown version
}
} else {
warning("ViennaRNA version unknown. Disabling")
available.tools["ViennaRNA"] <- FALSE # could not get version info
}
}
return(available.tools)
}
#' Copy MELTING Config File
#'
#' Copies modified MELTING tandem mismatch file to the MELTING data folder.
#'
#' @return TRUE if the file is available in the MELTING folder, FALSE otherwise.
#' @keywords internal
copy.melt.config <- function(melt.bin = NULL) {
print("DEPRECATED")
if (length(melt.bin) == 0) {
melt.bin <- Sys.which("melting-batch")[1]
}
tandem.mm.file <- system.file("extdata",
"AllawiSantaluciaPeyret1997_1998_1999tanmm_mod.xml",
package = "openPrimeR")
if (tandem.mm.file == "") {
warning("The MELTING config file is not present in the openPrimeR package.")
return(FALSE)
}
if (melt.bin != "" ) {
melt.config.file <- file.path(dirname(melt.bin),
"..", "Data", basename(tandem.mm.file))
if (!file.exists(melt.config.file)) {
message("Copying MELTING config to: ", melt.config.file)
s <- file.copy(tandem.mm.file, melt.config.file)
if (any(!s)) {
warning("Could not copy MELTING config file to destination.")
}
return(all(s))
} else {
# file is available
return(TRUE)
}
} else {
return(FALSE)
}
}
# actions to be performed when loading the package namespace
.onLoad <- function(libname, pkgname) {
################
# Define package options
#######
# order in which constraints are computed (least runtime to highest)
con.order <- c("primer_length", "gc_clamp", "gc_ratio", "no_runs", "no_repeats",
"melting_temp_range", "self_dimerization", "secondary_structure",
"primer_coverage", "primer_specificity",
"melting_temp_diff", "cross_dimerization")
# order in which constraints are relaxed (start with least important constraint)
relax.order <- c("primer_length", "primer_coverage", "no_repeats", "no_runs", "gc_clamp", "primer_specificity", "secondary_structure", "self_dimerization", "cross_dimerization", "gc_ratio", "melting_temp_range", "melting_temp_diff")
available.constraints <- select.constraints(con.order) # select constraints that can be computed by installed software
# message("Available constraints:", available.constraints)
con.order <- con.order[con.order %in% available.constraints]
relax.order <- relax.order[relax.order %in% available.constraints]
plot.colors <- c("Constraint" = "Set1", "Group" = "Set2",
"Run" = "Set3", "Primer" = "Accent")
op <- options()
op.openPrimeR <- list(
openPrimeR.constraint_order = con.order,
openPrimeR.relax_order = relax.order,
openPrimeR.plot_colors = plot.colors,
openPrimeR.plot_abbrev = 15 # limit label extent for plots
)
# only set options once:
toset <- !(names(op.openPrimeR) %in% names(op))
if (any(toset)) {
options(op.openPrimeR[toset])
}
# do not provide any output, even if no var is assigned to this function:
invisible()
}
# actions to be performed when attaching the package
.onAttach <- function(libname, pkgname) {
# add start up message
available.tools <- check.tool.function()
if (any(!available.tools)) {
tool.df <- build.tool.overview(available.tools)
out <- paste0("There are missing/non-functioning external tools.\n",
"To use the full potential of openPrimeR, please make sure\n",
"that the required versions of the speciied tools are\n
installed and that they are functional:\n")
idx <- which(!available.tools)
tools <- paste0("o ", names(available.tools)[idx],
" (", tool.df$URL[match(names(available.tools[idx]), tool.df$Tool)], ")",
collapse = "\n")
out <- paste(out, tools, sep = "")
packageStartupMessage(out)
# special warning for Pandoc (latex dependency)
if (Sys.which("pdflatex") == "") {
warning("'Pandoc' is non-functional, since 'pdflatex' is not installed on your system.")
}
}
# set the default number of cores to use
foreach.available <- requireNamespace("foreach", quietly = TRUE)
# register parallel backend if not registered already
if (foreach.available && !getDoParRegistered()) {
default.nbr.cores <- 2
if (Sys.info()["sysname"] != "Windows") {
# do not call parallel_setup for windows machines
# it seems that registering parallel workers leads to
# firewall issues -> TIMEOUT when loading the package
parallel_setup(default.nbr.cores)
}
}
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.